Skip to main content

Table 1 Primers and probes used for real-time PCR

From: Skeletal muscle metabolic gene response to carbohydrate feeding during exercise in the heat

Gene Primer 1 Primer 2 Probe
GAPDH TGTAGTTGAGGTCAATGAAGGG ACATCGCTCAGACACCATG AAGGTCGGAGTCAACGGATTTGGTC
MFN2 ATGCATCCCACTTAAGCAC CCAGAGGGCAGAACTTTCTC AGAGGCATCAGTGAGGTGCT
PGC-1α ATAAATCACACGGCGCTCTT TGAGAGGGCCAAGCAAAG AGAGGCAGAGGCAGAAGG
UCP3 CAAAATCCGGGTAGTGAGGCT TGACTCCGTCAAGCAGGTGTAC CCCCCAAAGGCGCGGACAAC
GLUT4 TCTTCACCTTGGTCTCGGTGTTGT CACGAAGCCAAAGATGGCCACAAT ATGTGTGGCTGTGCCATCCTGATGA
  1. GAPDH Glyceraldehyde 3-phosphate dehydrogenase, MFN2 mitofusin 2, PGC- peroxisome-proliferator- activated receptor-gamma co-activator 1 alpha, UCP3 uncoupling protein 3, GLUT4 glucose transporter 4.
\