Skip to main content

Advertisement

Table 4 Primer sequences for housekeeping genes

From: Minimal dose of milk protein concentrate to enhance the anabolic signalling response to a single bout of resistance exercise; a randomised controlled trial

Gene Sequence
EMC7 (Forward) GGGCTGGACAGACTTTCTAATG
EMC7 (Reverse) CTCCATTTCCCGTCTCATGTCAG
VCP (Forward) AAACTCATGGCGAGGTGGAG
VCP (Reverse) TGTCAAAGCGACCAAATCGC
CHMP2A (Forward) CGCTATGTGCGCAAGTTTGT
CHMP2A (Reverse) GGGGCAACTTCAGCTGTCTG
C1orf43 (Forward) CTATGGGACAGGGGTCTTTGG
C1orf43 (Reverse) TTTGGCTGCTGACTGGTGAT
HPRT (Forward) CCTGGCGTCGTGATTAGTGAT
HPRT (Reverse) TCGAGCAAGACGTTCAGTCC