Skip to main content

Advertisement

Table 3 Primer sequences

From: Minimal dose of milk protein concentrate to enhance the anabolic signalling response to a single bout of resistance exercise; a randomised controlled trial

LAT1 (Forward) CATCCTCCAGGCTCTTCTTCGTG
LAT1 (Reverse) AAGGCGTAGAGCAGCGTCAT
SNAT2 (Forward) GCAGTGGAATCCTTGGGCTT
SNAT2 (Reverse) AAAGACCCTCCTTCATTGGCAG
CAT1 (Forward) TCTCATTTAAGGTTCCCTTCCTG
CAT1 (Reverse) ACAGGCCATAGCCAAAGTAGA
PAT1 (Forward) CTTCTGCCGCAGGCTGAATAAA
PAT1 (Reverse) CAGGAAGAAGTCCACAACACG
SESTRIN1 (Forward) TTTCGTGTCCAGGACTATTGC
SESTRIN1 (Reverse) ACTGTCCCACATCTGGATAAAGG
SESTRIN2 (Forward) CAACCTCTTCTGGAGGCACTT
SESTRIN2 (Reverse) CCTGCTCAGGAGTCAGGTCA
SESTRIN3 (Forward) CAGGCAGCAACTTTGGGATTGT
SESTRIN3 (Reverse) AGACGCCTCTTCATCTTCCCTT