Skip to main content

Table 4 Oligonucleotide primers for ‘Real – Time’ PCR primers

From: Co-ingestion of carbohydrate and whey protein isolates enhance PGC-1α mRNA expression: a randomised, single blind, cross over study

Human genes Accession number Forward primer Reverse primer
   (5′ - 3′) (5′ - 3′)
Cyclophilin NM_021130.3 CATCTGCACTGCCAAGACTGA TTCATGCCTTCTTTCACTTTGC
GAPDH NM_002046.3 CAACGACCACTTTGTCAAGC TTACTCCTTGGAGGCCATGT
AMPK-α2 NM_006252.3 AACTGCAGAGAGCCATTCACTTT GGTGAAACTGAAGACAATGTGCTT
PGC-1α NM_013261.3 CAAGCCAAACCAACAACTTTATCTCT CACACTTAAGGTGCGTTCAATAGTC
Glycogen synthase NM_002103.4 GCTCCCTGTGGACTATGAGG ATTCCCATAACCGTGCACTC
\